DNA Sebagai Kode Genetik

DNA (Deoxyribonucleic acid) sudah sangat popular dikenal sebagai kode genetik, rasanya hampir setiap orang sudah mengenal istilah DNA sebagai pembeda tiap orang, maklum saat ini banyak sekali film atau sinetron yang menyajikan materi ini dalam tayangannya.

Kenapa DNA menjadi pembeda sebenarnya?

Mari kita bicarakan dengan bahasa yang sederhana saja tanpa memakai rumus-rumus struktur yang ruwet.

DNA dimiliki oleh setiap makhuk hidup (MH) yang ada di bumi ini mulai dari virus sebagai MH terkecil sampai paus biru yang merupakan MH terbesar zaman sekarang, atau juga MH yang sudah punah seperti dinosaurus. Jadi boleh kita sebut DNA ini adalah inti kehidupan di bumi. Perbedaan paling nyata antara MH kecil dan besar dilihat dari ukuran (panjang) untai DNA masing-masing dimana virus memiliki ukuran DNA paling pendek sedangkan mamalia besar ukuran DNA nya lebih  panjang. Ukuran DNA manusia sendiri secara umum dikatakan sekitar 2m.

Seperti dalam setiap bahasan dikatakan DNA sebetulnya hanya tersusun dari 4 macam senyawa yaitu Adenosin (A), Guanin (G), Sitosin (C), dan Timin (T), keempat senyawa basa ini yang akan saling terikat dan sambung menyambung. Urutan keempat senyawa ini yang berbeda-beda pada setiap individu.

Contoh :

Individu A urutannya : ATCGATGCTGATGACCTTGATC dan seterusnya

Individu B urutannya : TTCGGATGCTGACTAGACTATG dan seterusnya

Jelas terlihat perbedaan antar keduanya bukan? Bisa dibayangkan kalau jumlah senyawa yang tersusun itu sebanyak 3 milyar senyawa, akan sangat banyak sekali variasi.

Lantas apa fungsi dari masing-masing urutan senyawa itu ?

DNA pada pengertian sempit adalah suatu cetakan untuk membuat protein. Dimana urutan basa DNA tersebut akan menghasilkan cetakan dengan kode tertentu yaitu urutan tiap tiga basa. Tapi sebelum menjadi protein DNA mengalami perubahan menjadi RNA yang dikenal dengan istilah transkripsi dan dari RNA ini nantinya yang dijadikan sebagai protein melalui proses translasi.

Tiap tiga urutan basa DNA akan mengkode satu jenis asam amino yang selanjutnya asam amino-asam amino yang tersusun akan saling berikatan membentuk protein. Jadi jelas terlihat disini bahwa urutan asam amino yang selanjutnya menjadi protein dari dua individu akan berbeda. Inilah yang menyebabkan terdapatnya perbedaan antar MH.

Namun akan terdapat urutan basa yang sama dari MH dengan spesies yang sama, contoh dalam DNA tiap orang akan ada urutan basa yang  mengkode protein insulin (pemecah gula), urutan basa pengkode protein adrenalin, dan lain-lain yang merupakan protein yang esensial untuk metabolism tubuh, hanya saja urutan kemunculan atau letaknya yang berbeda pada tiap orang.

Semoga bisa bermanfaat penjelasan singkat ini.

Incoming search terms:

  • kode genetik (176)
  • pengertian kode genetik (43)
  • cara menggunakan buret (24)
  • makalah kode genetik (23)
  • kode genetik dna (22)
  • kode dna (10)
  • kode genetik pada dna (10)
Jika anda suka? Share it:

Leave a Comment